bla tem gene  (MBL Life science)

Journal: Veterinary and Animal Science

Article Title: Exploring of spectrum beta lactamase producing multidrug-resistant Salmonella enterica serovars in goat meat markets of Bangladesh

doi: 10.1016/j.vas.2024.100367

Figure Lengend Snippet: Primers used in PCR test of Salmonella enterica serovars and Beta-lactams resistant genes.

Article Snippet: This study specifically concentrated on the isolation and identification of ESBL-resistant genes ( bla TEM, bla SHV, bla CTX-M1, bla CTX-M2, bla CTX-M9, MultiCase ACC, MultiCase MOX, MultiCase DHA, bla OXA ) and the antibiogram profiling of Salmonella enterica serovars found in goat meat samples procured from retail outlets in Bangladesh.

Techniques: Sequencing

Journal: Veterinary and Animal Science

Article Title: Exploring of spectrum beta lactamase producing multidrug-resistant Salmonella enterica serovars in goat meat markets of Bangladesh

doi: 10.1016/j.vas.2024.100367

Figure Lengend Snippet: Amplified DNA of invA gene of Salmonella isolates at 284 bp, PC: Positive control as Salmonella spp. ATCC 700623 ( A); sefA gene of Salmonella Enteritidis Isolated at 488 bp, PC: Positive control as Salmonella enterica ser. Enteritidis ATCC 13076 ( B); fliC gene of Salmonella Typhimurium Isolated at 620 bp, PC: Positive control as Salmonella enterica ser. Typhimurium ATCC 700720 ( C); NC: Negative control (Nuclease free water) Amplified DNA of ESBL Resistance genes of Salmonella spp. from first multiplex PCR test. Lane M: 100bp DNA Ladder, Lane M: 100bp DNA ladder, bla TEM gene at 800bp position. Lane 2: bla SHV gene at 713 bp ( D).

Article Snippet: This study specifically concentrated on the isolation and identification of ESBL-resistant genes ( bla TEM, bla SHV, bla CTX-M1, bla CTX-M2, bla CTX-M9, MultiCase ACC, MultiCase MOX, MultiCase DHA, bla OXA ) and the antibiogram profiling of Salmonella enterica serovars found in goat meat samples procured from retail outlets in Bangladesh.

Techniques: Amplification, Positive Control, Isolation, Negative Control, Multiplex Assay

Journal: Veterinary and Animal Science

Article Title: Exploring of spectrum beta lactamase producing multidrug-resistant Salmonella enterica serovars in goat meat markets of Bangladesh

doi: 10.1016/j.vas.2024.100367

Figure Lengend Snippet: Frequency of beta-lactams resistance genes in Salmonella Enteritidis and Typhimurium isolated from retail goat meat.

Article Snippet: This study specifically concentrated on the isolation and identification of ESBL-resistant genes ( bla TEM, bla SHV, bla CTX-M1, bla CTX-M2, bla CTX-M9, MultiCase ACC, MultiCase MOX, MultiCase DHA, bla OXA ) and the antibiogram profiling of Salmonella enterica serovars found in goat meat samples procured from retail outlets in Bangladesh.

Techniques: Isolation

Journal: Antimicrobial Agents and Chemotherapy

Article Title: Role of Synonymous Mutations in the Evolution of TEM β-Lactamase Genes

doi: 10.1128/AAC.00018-21

Figure Lengend Snippet: Summary of the characteristics of the different bla TEM gene constructs without (−sm) and with (+sm) synonymous mutations

Article Snippet: Genes encoding the various bla TEM genes were purchased from Gen9, Inc. (Cambridge, MA) or Biomatik (Kitchener, ON, Canada); genes had a SacI restriction site followed by a ribosome binding site (5′- GAGCTCAAGAAGGAGATATACAT -3′) on the 5′ terminus and a BamHI restriction site (5′-GGATCC-3′) immediately following the 3′ terminal stop codon.

Techniques: Construct, Expressing

Journal: Antimicrobial Agents and Chemotherapy

Article Title: Role of Synonymous Mutations in the Evolution of TEM β-Lactamase Genes

doi: 10.1128/AAC.00018-21

Figure Lengend Snippet: Summary of the characteristics of the different gene constructs from bla TEM-1 to bla TEM-33 (+sm) c

Article Snippet: Genes encoding the various bla TEM genes were purchased from Gen9, Inc. (Cambridge, MA) or Biomatik (Kitchener, ON, Canada); genes had a SacI restriction site followed by a ribosome binding site (5′- GAGCTCAAGAAGGAGATATACAT -3′) on the 5′ terminus and a BamHI restriction site (5′-GGATCC-3′) immediately following the 3′ terminal stop codon.

Techniques: Construct, Diffusion-based Assay, Microdilution Assay

Journal: Antimicrobial Resistance and Infection Control

Article Title: High frequency and molecular epidemiology of metallo-β-lactamase-producing gram-negative bacilli in a tertiary care hospital in Lahore, Pakistan

doi: 10.1186/s13756-018-0417-y

Figure Lengend Snippet: List of the Primers used for the detection of ESBL-Type variant ( bla OXA, bla TEM and bla SHV) and MBL-type variants ( bla IMP-1 and bla VIM )

Article Snippet: The bla TEM gene was found to coexist with bla OXA -type variants in 21% ( n = 30) of the MBL producers.

Techniques: Variant Assay, Bla VIM Assay

Journal: Antimicrobial Resistance and Infection Control

Article Title: High frequency and molecular epidemiology of metallo-β-lactamase-producing gram-negative bacilli in a tertiary care hospital in Lahore, Pakistan

doi: 10.1186/s13756-018-0417-y

Figure Lengend Snippet: Frequencies of different gene variants ( TEM, SHV, OXA, VIM, IMP ) in MBL producing clinical isolates. The presence of genes bla OXA , bla TEM , bla SHV bla IMP-1 and bla VIM was detected in MBL strains through PCR

Article Snippet: The bla TEM gene was found to coexist with bla OXA -type variants in 21% ( n = 30) of the MBL producers.

Techniques: Bla VIM Assay

Journal: mBio

Article Title: Extensive Gene Amplification as a Mechanism for Piperacillin-Tazobactam Resistance in Escherichia coli

doi: 10.1128/mBio.00583-18

Figure Lengend Snippet: Effect of increasing tazobactam concentrations on E. coli susceptibility to TZP. MICs were determined for 907355 (A) and ATCC 35218 (B) via BMD in the presence of piperacillin (PIP) alone or TZP formulations containing different fixed concentrations (2 to 64 µg/ml) of tazobactam (TAZ). The MIC values in the legend are based on the concentration of piperacillin in the TZP formulation that inhibited growth. The range of MIC values obtained from six experiments is represented within each stacked bar on the graphs.

Article Snippet: The copy numbers per cell for E. coli 907355 and ATCC 35218 bla TEM-1 genes were determined using a SYBR green quantitative PCR (qPCR) assay after bacterial growth in cation-adjusted Mueller-Hinton broth (CAMHB) containing or lacking subinhibitory concentrations of TZP (4/4 μg/ml).

Techniques: Concentration Assay, Formulation

Journal: mBio

Article Title: Extensive Gene Amplification as a Mechanism for Piperacillin-Tazobactam Resistance in Escherichia coli

doi: 10.1128/mBio.00583-18

Figure Lengend Snippet: Effects of TZP on E. coli 907355 Bla TEM-1 levels and β-lactamase enzyme activity. (A) Detection of Bla TEM-1 in E. coli ATCC 25922 (lane 2), ATCC 35218 (lanes 3 to 5), and 907355 (lanes 6 to 9) by Western immunoblotting. Strains were cultured in medium containing no antibiotic (lanes 2, 3, and 6), 4 µg/ml tazobactam (lanes 4 and 7), 4 µg/ml piperacillin (lanes 5 and 8), or 4/4 µg/ml TZP (lane 9) prior to protein sample collection. Molecular mass standards are shown in lane 1 (kilodaltons are indicated to the left of the blot). The estimated molecular mass of Bla TEM-1 is 31.5 kDa. This experiment was repeated on independently collected samples and yielded similar results. (B) Determination of Bla TEM-1 activity in E. coli 907355 via a nitrocefin hydrolysis assay after growth in the presence or absence of 4/4 µg/ml TZP. ATCC 35218 Bla TEM-1 activity is included as a comparison but was not determined (ND) in the presence of TZP due to lack of growth. Units on the y axis denote the micromoles of nitrocefin hydrolyzed per milligram of total protein per minute. The values above each bar on the graph represent the means of 3 experiments, and the error bars indicate the standard deviations of the means.

Article Snippet: The copy numbers per cell for E. coli 907355 and ATCC 35218 bla TEM-1 genes were determined using a SYBR green quantitative PCR (qPCR) assay after bacterial growth in cation-adjusted Mueller-Hinton broth (CAMHB) containing or lacking subinhibitory concentrations of TZP (4/4 μg/ml).

Techniques: Activity Assay, Western Blot, Cell Culture, Hydrolysis Assay, Comparison

Journal: mBio

Article Title: Extensive Gene Amplification as a Mechanism for Piperacillin-Tazobactam Resistance in Escherichia coli

doi: 10.1128/mBio.00583-18

Figure Lengend Snippet: Estimation of bla TEM-1 copy number by qPCR. bla TEM-1 copy number per cell was measured using a real-time SYBR green qPCR assay after bacterial growth in the absence or presence of 4/4 µg/ml TZP. The copy number was not determined (ND) for ATCC 35218 in the presence of TZP due to lack of growth. The values above each bar on the graph represent the mean results of 3 experiments, and the error bars indicate the standard deviations of the means.

Article Snippet: The copy numbers per cell for E. coli 907355 and ATCC 35218 bla TEM-1 genes were determined using a SYBR green quantitative PCR (qPCR) assay after bacterial growth in cation-adjusted Mueller-Hinton broth (CAMHB) containing or lacking subinhibitory concentrations of TZP (4/4 μg/ml).

Techniques: SYBR Green Assay

Journal: Indian Journal of Ophthalmology

Article Title: Prevalence and antibacterial resistance patterns of extended-spectrum beta-lactamase producing Gram-negative bacteria isolated from ocular infections

doi: 10.4103/0301-4738.182943

Figure Lengend Snippet: Phenotypic confirmatory test results of cephalosporin/ clavulanate combination disc test. (a) Negative control E. coli ATCC 25922; (b) positive control K. pneumoniae ATCC 700603; (c) test isolate E. coli 3923 from canaliculus pus specimen. CTX: Cefotaxime (30 μg), CAZ: Ceftazidime (30 μg), CTX/CA: Cefotaxime/clavulanic acid (30 μg/10 μg), CAZ/CA: Ceftazidime/clavulanic acid (30 μg/10 μg). E. coli : Escherichia coli , K. pneumonia : Klebsiella pneumoniae

Article Snippet: Along with the test isolates, DNA of bla CTX-M -gene carrying E. coli 4712 (positive control for bla CTX-M-15 ; GenBank accession number KC200080), DNA of bla SHV -gene carrying K. pneumoniae (ATCC 700603) (positive control for bla SHV -gene),[ ] DNA of bla TEM -gene carrying E. coli (ATCC 35218) (positive control for bla TEM -gene),[ ] DNA of bla OXA -gene laboratory isolate of K. pneumoniae 7888 (positive control for bla OXA -gene GenBank accession number JN565742), and DNA of non-ESBL-producing organism, E. coli ATCC 25922 were also extracted for performing positive and negative control during each mPCR.

Techniques: Negative Control, Positive Control

Journal: Indian Journal of Ophthalmology

Article Title: Prevalence and antibacterial resistance patterns of extended-spectrum beta-lactamase producing Gram-negative bacteria isolated from ocular infections

doi: 10.4103/0301-4738.182943

Figure Lengend Snippet: Agarose gel electrophoresis of multiplex polymerase chain reaction products for bla TEM , bla SHV , and bla OXA -genes. Lane NC1 and NC2: Negative controls, Lane 1: E. coli ATCC 25922 (negative control for extended-spectrum beta-lactamase genes), Lane 2: P. aeruginosa 13134 strain positive for bla TEM -gene (800 bp) alone, Lane 3: E. agglomerans 4245 strain positive for bla SHV -gene (713 bp) alone, Lane 4: P. aeruginosa 13111 strain positive for bla OXA -gene (564 bp) alone, Lane 5: P. aeruginosa 4211 strain positive for both bla TEM and bla SHV -genes (800 bp and 713 bp), Lane 6: P. aeruginosa 12839 strain positive for both bla TEM and bla OXA -genes (800 bp, 564 bp), Lane 7: A. hydrophila 4019 strain positive for both bla SHV and bla OXA -genes (713 bp, 564 bp), Lane PC: Positive control, Lane MW – Marker 100 bp DNA ladder. E. coli : Escherichia coli , P. aeruginosa : Pseudomonas aeruginosa , A. hydrophila: Aeromonas hydrophila , E. agglomerans : Enterobacter agglomerans

Article Snippet: Along with the test isolates, DNA of bla CTX-M -gene carrying E. coli 4712 (positive control for bla CTX-M-15 ; GenBank accession number KC200080), DNA of bla SHV -gene carrying K. pneumoniae (ATCC 700603) (positive control for bla SHV -gene),[ ] DNA of bla TEM -gene carrying E. coli (ATCC 35218) (positive control for bla TEM -gene),[ ] DNA of bla OXA -gene laboratory isolate of K. pneumoniae 7888 (positive control for bla OXA -gene GenBank accession number JN565742), and DNA of non-ESBL-producing organism, E. coli ATCC 25922 were also extracted for performing positive and negative control during each mPCR.

Techniques: Agarose Gel Electrophoresis, Multiplex Assay, Polymerase Chain Reaction, Negative Control, Positive Control, Marker